Updates are available Correction dated 2025-07-16

Article History

Received: 11 November 2024

Revised: 2 May 2025

Accepted: 3 June 2025

First Online: 16 June 2025

Change Date: 9 July 2025

Change Type: Update

Change Details: The original online version of this article was revised: In Table 2 of the original publication, the sequence entries for ACTN3 and mice MSTN were incorrectly duplicated. Specifically, the segment "CCCGAGGCTGACCGAGAGCG" for ACTN3 and "GACGATTATCACGCTACCA" for mice MSTN appeared twice within each respective sequence. These duplications were introduced during the final typesetting process.

Change Date: 16 July 2025

Change Type: Correction

Change Details: A Correction to this paper has been published:

Change Details: https://doi.org/10.1007/s00216-025-06004-w

Declarations

:

: This experiment was conducted in accordance with protocols approved by the Animal Ethics Committee and the LMO Safety Committee (approval numbers: SKL-J-23032, SKL46-023).

: The authors declare no competing interests.

: All animal procedures were performed in compliance with internationally accepted guidelines for the care and use of laboratory animals and institutional regulations.

: All biological samples used in this study were obtained from laboratory mice maintained by Sankyo Lab Service Corporation (Tokyo, Japan), under institutional animal care protocols.