Crossmark

Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer

Crossref DOI link: https://doi.org/10.1007/s12032-018-1178-4

Published Online: 2018-08-18

Published Print: 2018-10

Update policy: https://doi.org/10.1007/springer_crossmark_policy

Authors

Lin, Zhifeng

Xiong, Liwen

Lin, Qiang
License Information

Text and Data Mining valid from 2018-08-18
More Information

Article History

First Online: 18 August 2018

Change Date: 3 May 2019

Change Type: Correction

Change Details: The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as "TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT".