Updates are available Correction dated 2026-02-12
Click to view Correction: https://doi.org/10.1038/s41417-026-01006-x
-
Authors
Li, Jingya https://orcid.org/0009-0008-1255-447X
Li, Mengdi
Wang, Wenchen
Jiang, Guancheng
Wang, Yinyin
Sheng, Jianqiu
Chang, Zhijie https://orcid.org/0000-0003-1567-3227
Sheng, Jian https://orcid.org/0000-0001-9027-3384
Li, Mingyang https://orcid.org/0000-0003-1567-7121
Ren, Fangli https://orcid.org/0000-0003-1858-6989
-
Funding
Funding for this research was provided by:
National Natural Science Foundation of China (82430087)
- License Information
-
More Information
Article History
Received: 11 March 2025
Accepted: 5 September 2025
First Online: 22 November 2025
Change Date: 18 February 2026
Change Type: Update
Change Details: The original online version of this article was revised: In section 'MATERIALS AND METHODS', in the sentence beginning 'Human CREPT promoter sequences...' in this article, the sequence 'acccccgtggcagtaagaaaaac' should have read 'ttaccgactgacagactgccagg'.
Change Date: 12 February 2026
Change Type: Correction
Change Details: A Correction to this paper has been published:
Change Details: https://doi.org/10.1038/s41417-026-01006-x
Competing interests
: The authors declare no competing interests.
: All animal experiments were performed in accordance with relevant guidelines and regulations and were approved by the Institutional Animal Care and Use Committee of Tsinghua University. The animal work was conducted under the protocol 20-CZJ-2. The research involving human participants was approved by the Clinical Ethics Committee of the Chinese PLA General Hospital (Approval Number: S2022-610-01). Informed consent was obtained from all participants.
