Updates are available Correction dated 2018-10-15
Click to view Correction: https://doi.org/10.1038/s41467-018-06909-4
-
Authors
Dong, Chen
Fontana, Jason
Patel, Anika
Carothers, James M. http://orcid.org/0000-0001-6728-7833
Zalatan, Jesse G. http://orcid.org/0000-0002-1458-0654
- License Information
-
More Information
Article History
Received: 5 February 2018
Accepted: 1 June 2018
First Online: 27 June 2018
Change Date: 15 October 2018
Change Type: Correction
Change Details: In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT’. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.
Competing interests
: The authors declare no competing interests.
