Document is current
Any future updates will be listed below
-
Authors
Yoshimura, Yuki
Watanabe, Tatsuo
Nakamura, Kazuomi
Futatsugi, Akira
Mikoshiba, Katsuhiko
Hiyama, Takeshi Y.
-
Funding
Funding for this research was provided by:
Ministry of Education, Culture, Sports, Science and Technology (22K06055, 15K08207, 21K18269)
Japan Agency for Medical Research and Development (JP23gm1510001)
- License Information
-
More Information
Article History
Received: 8 August 2024
Accepted: 18 November 2024
First Online: 3 December 2024
Change Date: 25 September 2025
Change Type: Update
Change Details: The original online version of this Article was revised: The Supplementary Information file published with this Article contained an error in Table S2, where the primer sequence of ‘KI check primer F’ was incorrectly listed as “ggtattggggttcacacaccagcac”. The correct sequence now reads “gagaaggggatttgagATAACTTCGTATAG”. This error has been corrected in the Supplementary Information file that accompanies the original Article.
Declarations
:
: The authors declare no competing interests.
