Kampmann, Martin
Bassik, Michael C
Weissman, Jonathan S
Article History
First Online: 3 July 2014
Change Date: 16 January 2015
Change Type: Corrigendum
Change Details: In the version of this article initially published, a sentence in Step 49 read "Order the top and bottom oligonucleotides corresponding to hit shRNA sequences formatted as in the example below for the target site TTTCTTACTCACCCTAAGAACT". The sentence has been corrected to replace 'target site' with 'guide sequence'. The error has been corrected in the HTML and PDF versions of the article.
Competing interests
: The authors declare no competing financial interests.