Yang, Ling
Li, Wan
Jiang, Gui-Ze
Zhang, Wen-Hui
Ding, Huan-Zhong
Liu, Ya-Hong
Zeng, Zhen-Ling
Jiang, Hong-Xia
Article History
Received: 5 July 2016
Accepted: 8 December 2016
First Online: 18 January 2017
Change Date: 26 April 2017
Change Type: Update
Change Details: A correction has been published and is appended to both the HTML and PDF versions of this paper. The error has not been fixed in the paper.
Change Date: 26 April 2017
Change Type: Erratum
Change Details: Scientific Reports 7: Article number: 40710; published online: 18 January 2017; updated: 26 April 2017 This Article contains errors in the Materials and Methods section under subheading ‘Prevalence investigation of P1-like bacteriophage in Salmonella isolates’, where incorrect primers were quoted. “The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)”.
Competing interests
: The authors declare no competing financial interests.